ID: 1131661324

View in Genome Browser
Species Human (GRCh38)
Location 15:94521051-94521073
Sequence CATGCAGCTCCTTCTGCACG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131661324_1131661331 26 Left 1131661324 15:94521051-94521073 CCCCGTGCAGAAGGAGCTGCATG No data
Right 1131661331 15:94521100-94521122 TCAAGGATTATTAACATTCCTGG No data
1131661324_1131661328 9 Left 1131661324 15:94521051-94521073 CCCCGTGCAGAAGGAGCTGCATG No data
Right 1131661328 15:94521083-94521105 GACCAATACTCCTAAATTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131661324 Original CRISPR CATGCAGCTCCTTCTGCACG GGG (reversed) Intergenic
No off target data available for this crispr