ID: 1131663523

View in Genome Browser
Species Human (GRCh38)
Location 15:94544478-94544500
Sequence TGTAGCATCTGCCAGAGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131663523_1131663527 25 Left 1131663523 15:94544478-94544500 CCCTGGCTCTGGCAGATGCTACA No data
Right 1131663527 15:94544526-94544548 TTCCCCATGTATTCTGCTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131663523 Original CRISPR TGTAGCATCTGCCAGAGCCA GGG (reversed) Intergenic
No off target data available for this crispr