ID: 1131663678

View in Genome Browser
Species Human (GRCh38)
Location 15:94546326-94546348
Sequence AAGGCTCCTTCATTTATGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131663678_1131663685 19 Left 1131663678 15:94546326-94546348 CCAGGCATAAATGAAGGAGCCTT No data
Right 1131663685 15:94546368-94546390 CCACTAAGTCACCCCATCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131663678 Original CRISPR AAGGCTCCTTCATTTATGCC TGG (reversed) Intergenic
No off target data available for this crispr