ID: 1131664237

View in Genome Browser
Species Human (GRCh38)
Location 15:94553200-94553222
Sequence TTCTGGAATTTCCAGATAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131664234_1131664237 24 Left 1131664234 15:94553153-94553175 CCTATATATGCAAAAAATGTACA No data
Right 1131664237 15:94553200-94553222 TTCTGGAATTTCCAGATAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131664237 Original CRISPR TTCTGGAATTTCCAGATAGT GGG Intergenic
No off target data available for this crispr