ID: 1131665959

View in Genome Browser
Species Human (GRCh38)
Location 15:94571372-94571394
Sequence TTTTAGTTAAATATCTGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131665954_1131665959 19 Left 1131665954 15:94571330-94571352 CCTCCCTCAGAAGCAAGCAGGGA No data
Right 1131665959 15:94571372-94571394 TTTTAGTTAAATATCTGGGAAGG No data
1131665956_1131665959 15 Left 1131665956 15:94571334-94571356 CCTCAGAAGCAAGCAGGGAAAGA No data
Right 1131665959 15:94571372-94571394 TTTTAGTTAAATATCTGGGAAGG No data
1131665955_1131665959 16 Left 1131665955 15:94571333-94571355 CCCTCAGAAGCAAGCAGGGAAAG No data
Right 1131665959 15:94571372-94571394 TTTTAGTTAAATATCTGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131665959 Original CRISPR TTTTAGTTAAATATCTGGGA AGG Intergenic
No off target data available for this crispr