ID: 1131668409

View in Genome Browser
Species Human (GRCh38)
Location 15:94594761-94594783
Sequence ACGGCCACACACATCCAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131668409_1131668417 29 Left 1131668409 15:94594761-94594783 CCTTGCTGGATGTGTGTGGCCGT No data
Right 1131668417 15:94594813-94594835 CTGGAAATTGTAGTGGGTAGAGG No data
1131668409_1131668416 23 Left 1131668409 15:94594761-94594783 CCTTGCTGGATGTGTGTGGCCGT No data
Right 1131668416 15:94594807-94594829 TCTCAGCTGGAAATTGTAGTGGG No data
1131668409_1131668414 10 Left 1131668409 15:94594761-94594783 CCTTGCTGGATGTGTGTGGCCGT No data
Right 1131668414 15:94594794-94594816 ACAGATGTTTGACTCTCAGCTGG No data
1131668409_1131668415 22 Left 1131668409 15:94594761-94594783 CCTTGCTGGATGTGTGTGGCCGT No data
Right 1131668415 15:94594806-94594828 CTCTCAGCTGGAAATTGTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131668409 Original CRISPR ACGGCCACACACATCCAGCA AGG (reversed) Intergenic
No off target data available for this crispr