ID: 1131669280

View in Genome Browser
Species Human (GRCh38)
Location 15:94601954-94601976
Sequence ATCCCACAGCATCCCAGGAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131669280_1131669283 2 Left 1131669280 15:94601954-94601976 CCGTTCCTGGGATGCTGTGGGAT No data
Right 1131669283 15:94601979-94602001 TGGTTTATAAATCACTCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131669280 Original CRISPR ATCCCACAGCATCCCAGGAA CGG (reversed) Intergenic
No off target data available for this crispr