ID: 1131670623

View in Genome Browser
Species Human (GRCh38)
Location 15:94615923-94615945
Sequence ATGGCTACACTGATCTCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131670623_1131670634 21 Left 1131670623 15:94615923-94615945 CCCTGTGAGATCAGTGTAGCCAT No data
Right 1131670634 15:94615967-94615989 AAAAATTAGTGTGTGGAACAAGG No data
1131670623_1131670631 14 Left 1131670623 15:94615923-94615945 CCCTGTGAGATCAGTGTAGCCAT No data
Right 1131670631 15:94615960-94615982 CCTCCCAAAAAATTAGTGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131670623 Original CRISPR ATGGCTACACTGATCTCACA GGG (reversed) Intergenic
No off target data available for this crispr