ID: 1131670668

View in Genome Browser
Species Human (GRCh38)
Location 15:94616367-94616389
Sequence TTTCCTCTCATTAAAATGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131670668_1131670673 8 Left 1131670668 15:94616367-94616389 CCCCACATTTTAATGAGAGGAAA No data
Right 1131670673 15:94616398-94616420 TCCTGAGTTTAACAGTGTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131670668 Original CRISPR TTTCCTCTCATTAAAATGTG GGG (reversed) Intergenic
No off target data available for this crispr