ID: 1131671643

View in Genome Browser
Species Human (GRCh38)
Location 15:94626145-94626167
Sequence GAAGCCTCTGGGTGGCCCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131671637_1131671643 9 Left 1131671637 15:94626113-94626135 CCTGCTGCCTACTTGGTGTGAGA No data
Right 1131671643 15:94626145-94626167 GAAGCCTCTGGGTGGCCCTGAGG No data
1131671636_1131671643 10 Left 1131671636 15:94626112-94626134 CCCTGCTGCCTACTTGGTGTGAG No data
Right 1131671643 15:94626145-94626167 GAAGCCTCTGGGTGGCCCTGAGG No data
1131671638_1131671643 2 Left 1131671638 15:94626120-94626142 CCTACTTGGTGTGAGAGCCTCTT No data
Right 1131671643 15:94626145-94626167 GAAGCCTCTGGGTGGCCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131671643 Original CRISPR GAAGCCTCTGGGTGGCCCTG AGG Intergenic
No off target data available for this crispr