ID: 1131672283

View in Genome Browser
Species Human (GRCh38)
Location 15:94632405-94632427
Sequence CAGAAGGTGAATCTTGTACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131672283_1131672285 2 Left 1131672283 15:94632405-94632427 CCTTGTACAAGATTCACCTTCTG No data
Right 1131672285 15:94632430-94632452 GCTTGTTTCTCTTCACACCCTGG No data
1131672283_1131672290 30 Left 1131672283 15:94632405-94632427 CCTTGTACAAGATTCACCTTCTG No data
Right 1131672290 15:94632458-94632480 GTGGCATTTTCTTTGGTGTAAGG No data
1131672283_1131672286 11 Left 1131672283 15:94632405-94632427 CCTTGTACAAGATTCACCTTCTG No data
Right 1131672286 15:94632439-94632461 TCTTCACACCCTGGATGCTGTGG No data
1131672283_1131672289 23 Left 1131672283 15:94632405-94632427 CCTTGTACAAGATTCACCTTCTG No data
Right 1131672289 15:94632451-94632473 GGATGCTGTGGCATTTTCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131672283 Original CRISPR CAGAAGGTGAATCTTGTACA AGG (reversed) Intergenic
No off target data available for this crispr