ID: 1131680389

View in Genome Browser
Species Human (GRCh38)
Location 15:94715698-94715720
Sequence CTGCTCGCTTTGCCATGAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131680389_1131680396 30 Left 1131680389 15:94715698-94715720 CCACTTCATGGCAAAGCGAGCAG No data
Right 1131680396 15:94715751-94715773 ATAAAACATAGACATAGATTAGG No data
1131680389_1131680392 -1 Left 1131680389 15:94715698-94715720 CCACTTCATGGCAAAGCGAGCAG No data
Right 1131680392 15:94715720-94715742 GCCGGATTTGACTGGCCTGAAGG No data
1131680389_1131680394 0 Left 1131680389 15:94715698-94715720 CCACTTCATGGCAAAGCGAGCAG No data
Right 1131680394 15:94715721-94715743 CCGGATTTGACTGGCCTGAAGGG No data
1131680389_1131680391 -9 Left 1131680389 15:94715698-94715720 CCACTTCATGGCAAAGCGAGCAG No data
Right 1131680391 15:94715712-94715734 AGCGAGCAGCCGGATTTGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131680389 Original CRISPR CTGCTCGCTTTGCCATGAAG TGG (reversed) Intergenic
No off target data available for this crispr