ID: 1131681484

View in Genome Browser
Species Human (GRCh38)
Location 15:94728439-94728461
Sequence AGGATATTGCCCCGGGGCCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131681484_1131681490 15 Left 1131681484 15:94728439-94728461 CCACGGCCCCGGGGCAATATCCT No data
Right 1131681490 15:94728477-94728499 GAAAGAAAATAAGTGTCTTTTGG No data
1131681484_1131681488 -9 Left 1131681484 15:94728439-94728461 CCACGGCCCCGGGGCAATATCCT No data
Right 1131681488 15:94728453-94728475 CAATATCCTGAAGTTGTTTGAGG No data
1131681484_1131681491 16 Left 1131681484 15:94728439-94728461 CCACGGCCCCGGGGCAATATCCT No data
Right 1131681491 15:94728478-94728500 AAAGAAAATAAGTGTCTTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131681484 Original CRISPR AGGATATTGCCCCGGGGCCG TGG (reversed) Intergenic