ID: 1131686014

View in Genome Browser
Species Human (GRCh38)
Location 15:94768416-94768438
Sequence CCTGAACTCCCCCCCTGCAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131686014_1131686021 24 Left 1131686014 15:94768416-94768438 CCCGTGCAGGGGGGGAGTTCAGG No data
Right 1131686021 15:94768463-94768485 AACAACAATACCAAGGAAAGTGG No data
1131686014_1131686020 17 Left 1131686014 15:94768416-94768438 CCCGTGCAGGGGGGGAGTTCAGG No data
Right 1131686020 15:94768456-94768478 AAAACTCAACAACAATACCAAGG No data
1131686014_1131686018 -6 Left 1131686014 15:94768416-94768438 CCCGTGCAGGGGGGGAGTTCAGG No data
Right 1131686018 15:94768433-94768455 TTCAGGTTTAGGTTGCCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131686014 Original CRISPR CCTGAACTCCCCCCCTGCAC GGG (reversed) Intergenic
No off target data available for this crispr