ID: 1131692438

View in Genome Browser
Species Human (GRCh38)
Location 15:94841735-94841757
Sequence GTGAGCAATGAGCAAGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131692438_1131692443 14 Left 1131692438 15:94841735-94841757 CCTTCCACTTGCTCATTGCTCAC No data
Right 1131692443 15:94841772-94841794 TGGGTTTGTCCTGATTCTTCAGG No data
1131692438_1131692440 -6 Left 1131692438 15:94841735-94841757 CCTTCCACTTGCTCATTGCTCAC No data
Right 1131692440 15:94841752-94841774 GCTCACACTCCTTCATGACTTGG No data
1131692438_1131692441 -5 Left 1131692438 15:94841735-94841757 CCTTCCACTTGCTCATTGCTCAC No data
Right 1131692441 15:94841753-94841775 CTCACACTCCTTCATGACTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131692438 Original CRISPR GTGAGCAATGAGCAAGTGGA AGG (reversed) Intergenic
No off target data available for this crispr