ID: 1131692844

View in Genome Browser
Species Human (GRCh38)
Location 15:94845182-94845204
Sequence GCGGCAGCGACACGCGCGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131692832_1131692844 22 Left 1131692832 15:94845137-94845159 CCTCCTGGCGAGGCGCGGCCGGC No data
Right 1131692844 15:94845182-94845204 GCGGCAGCGACACGCGCGGCCGG No data
1131692834_1131692844 19 Left 1131692834 15:94845140-94845162 CCTGGCGAGGCGCGGCCGGCGGA No data
Right 1131692844 15:94845182-94845204 GCGGCAGCGACACGCGCGGCCGG No data
1131692839_1131692844 4 Left 1131692839 15:94845155-94845177 CCGGCGGAAAAGCTTGGTGGGGT No data
Right 1131692844 15:94845182-94845204 GCGGCAGCGACACGCGCGGCCGG No data
1131692829_1131692844 30 Left 1131692829 15:94845129-94845151 CCTCGCGGCCTCCTGGCGAGGCG No data
Right 1131692844 15:94845182-94845204 GCGGCAGCGACACGCGCGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131692844 Original CRISPR GCGGCAGCGACACGCGCGGC CGG Intergenic