ID: 1131693130

View in Genome Browser
Species Human (GRCh38)
Location 15:94847405-94847427
Sequence CAGGATAATCAGATGTAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131693130_1131693137 18 Left 1131693130 15:94847405-94847427 CCCTCCTACATCTGATTATCCTG No data
Right 1131693137 15:94847446-94847468 GAATGACCTTGCCTTTCATCTGG No data
1131693130_1131693134 -4 Left 1131693130 15:94847405-94847427 CCCTCCTACATCTGATTATCCTG No data
Right 1131693134 15:94847424-94847446 CCTGCATTTTTCCCACTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131693130 Original CRISPR CAGGATAATCAGATGTAGGA GGG (reversed) Intergenic
No off target data available for this crispr