ID: 1131693528

View in Genome Browser
Species Human (GRCh38)
Location 15:94852278-94852300
Sequence TCATCCTTCTTAATTGGTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131693525_1131693528 3 Left 1131693525 15:94852252-94852274 CCTTTATCATTGTGCAATGGCCT No data
Right 1131693528 15:94852278-94852300 TCATCCTTCTTAATTGGTATTGG No data
1131693524_1131693528 4 Left 1131693524 15:94852251-94852273 CCCTTTATCATTGTGCAATGGCC No data
Right 1131693528 15:94852278-94852300 TCATCCTTCTTAATTGGTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131693528 Original CRISPR TCATCCTTCTTAATTGGTAT TGG Intergenic
No off target data available for this crispr