ID: 1131694591

View in Genome Browser
Species Human (GRCh38)
Location 15:94862477-94862499
Sequence GTGACACATGTCTACTAGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131694589_1131694591 12 Left 1131694589 15:94862442-94862464 CCTACCTGAAGAACATTTCTGTT No data
Right 1131694591 15:94862477-94862499 GTGACACATGTCTACTAGTAAGG No data
1131694590_1131694591 8 Left 1131694590 15:94862446-94862468 CCTGAAGAACATTTCTGTTTTTT No data
Right 1131694591 15:94862477-94862499 GTGACACATGTCTACTAGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131694591 Original CRISPR GTGACACATGTCTACTAGTA AGG Intergenic
No off target data available for this crispr