ID: 1131703793

View in Genome Browser
Species Human (GRCh38)
Location 15:94970850-94970872
Sequence CGAGGAGGACACGGAGGGCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131703793_1131703802 8 Left 1131703793 15:94970850-94970872 CCGTGCCCTCCGTGTCCTCCTCG No data
Right 1131703802 15:94970881-94970903 ATAGAAGTGAGTGGGTCATTTGG No data
1131703793_1131703801 0 Left 1131703793 15:94970850-94970872 CCGTGCCCTCCGTGTCCTCCTCG No data
Right 1131703801 15:94970873-94970895 GTGTGCTGATAGAAGTGAGTGGG No data
1131703793_1131703800 -1 Left 1131703793 15:94970850-94970872 CCGTGCCCTCCGTGTCCTCCTCG No data
Right 1131703800 15:94970872-94970894 GGTGTGCTGATAGAAGTGAGTGG No data
1131703793_1131703803 20 Left 1131703793 15:94970850-94970872 CCGTGCCCTCCGTGTCCTCCTCG No data
Right 1131703803 15:94970893-94970915 GGGTCATTTGGCATTAGCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131703793 Original CRISPR CGAGGAGGACACGGAGGGCA CGG (reversed) Intergenic
No off target data available for this crispr