ID: 1131703795

View in Genome Browser
Species Human (GRCh38)
Location 15:94970855-94970877
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131703795_1131703801 -5 Left 1131703795 15:94970855-94970877 CCCTCCGTGTCCTCCTCGGTGTG No data
Right 1131703801 15:94970873-94970895 GTGTGCTGATAGAAGTGAGTGGG No data
1131703795_1131703800 -6 Left 1131703795 15:94970855-94970877 CCCTCCGTGTCCTCCTCGGTGTG No data
Right 1131703800 15:94970872-94970894 GGTGTGCTGATAGAAGTGAGTGG No data
1131703795_1131703802 3 Left 1131703795 15:94970855-94970877 CCCTCCGTGTCCTCCTCGGTGTG No data
Right 1131703802 15:94970881-94970903 ATAGAAGTGAGTGGGTCATTTGG No data
1131703795_1131703803 15 Left 1131703795 15:94970855-94970877 CCCTCCGTGTCCTCCTCGGTGTG No data
Right 1131703803 15:94970893-94970915 GGGTCATTTGGCATTAGCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131703795 Original CRISPR CACACCGAGGAGGACACGGA GGG (reversed) Intergenic
No off target data available for this crispr