ID: 1131703801

View in Genome Browser
Species Human (GRCh38)
Location 15:94970873-94970895
Sequence GTGTGCTGATAGAAGTGAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131703796_1131703801 -6 Left 1131703796 15:94970856-94970878 CCTCCGTGTCCTCCTCGGTGTGC No data
Right 1131703801 15:94970873-94970895 GTGTGCTGATAGAAGTGAGTGGG No data
1131703792_1131703801 3 Left 1131703792 15:94970847-94970869 CCACCGTGCCCTCCGTGTCCTCC No data
Right 1131703801 15:94970873-94970895 GTGTGCTGATAGAAGTGAGTGGG No data
1131703795_1131703801 -5 Left 1131703795 15:94970855-94970877 CCCTCCGTGTCCTCCTCGGTGTG No data
Right 1131703801 15:94970873-94970895 GTGTGCTGATAGAAGTGAGTGGG No data
1131703793_1131703801 0 Left 1131703793 15:94970850-94970872 CCGTGCCCTCCGTGTCCTCCTCG No data
Right 1131703801 15:94970873-94970895 GTGTGCTGATAGAAGTGAGTGGG No data
1131703797_1131703801 -9 Left 1131703797 15:94970859-94970881 CCGTGTCCTCCTCGGTGTGCTGA No data
Right 1131703801 15:94970873-94970895 GTGTGCTGATAGAAGTGAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131703801 Original CRISPR GTGTGCTGATAGAAGTGAGT GGG Intergenic
No off target data available for this crispr