ID: 1131708853

View in Genome Browser
Species Human (GRCh38)
Location 15:95030518-95030540
Sequence TCCATCCCACACATAGACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131708853_1131708857 26 Left 1131708853 15:95030518-95030540 CCAGGGTCTATGTGTGGGATGGA No data
Right 1131708857 15:95030567-95030589 AGAGAGTTCTCAAAGAGGATGGG No data
1131708853_1131708856 25 Left 1131708853 15:95030518-95030540 CCAGGGTCTATGTGTGGGATGGA No data
Right 1131708856 15:95030566-95030588 GAGAGAGTTCTCAAAGAGGATGG No data
1131708853_1131708854 -7 Left 1131708853 15:95030518-95030540 CCAGGGTCTATGTGTGGGATGGA No data
Right 1131708854 15:95030534-95030556 GGATGGACAGTGTGATTACAAGG No data
1131708853_1131708855 21 Left 1131708853 15:95030518-95030540 CCAGGGTCTATGTGTGGGATGGA No data
Right 1131708855 15:95030562-95030584 ATATGAGAGAGTTCTCAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131708853 Original CRISPR TCCATCCCACACATAGACCC TGG (reversed) Intergenic
No off target data available for this crispr