ID: 1131712674

View in Genome Browser
Species Human (GRCh38)
Location 15:95073174-95073196
Sequence ATCTGCAGAAAGGCTGAGCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131712674_1131712678 3 Left 1131712674 15:95073174-95073196 CCGAGCTCAGCCTTTCTGCAGAT No data
Right 1131712678 15:95073200-95073222 ATCAGCAGAGGCAGCAATTAGGG No data
1131712674_1131712681 25 Left 1131712674 15:95073174-95073196 CCGAGCTCAGCCTTTCTGCAGAT No data
Right 1131712681 15:95073222-95073244 GCTCATTAGAAAGGTGTTTTGGG No data
1131712674_1131712679 16 Left 1131712674 15:95073174-95073196 CCGAGCTCAGCCTTTCTGCAGAT No data
Right 1131712679 15:95073213-95073235 GCAATTAGGGCTCATTAGAAAGG No data
1131712674_1131712676 -9 Left 1131712674 15:95073174-95073196 CCGAGCTCAGCCTTTCTGCAGAT No data
Right 1131712676 15:95073188-95073210 TCTGCAGATCTCATCAGCAGAGG No data
1131712674_1131712680 24 Left 1131712674 15:95073174-95073196 CCGAGCTCAGCCTTTCTGCAGAT No data
Right 1131712680 15:95073221-95073243 GGCTCATTAGAAAGGTGTTTTGG No data
1131712674_1131712677 2 Left 1131712674 15:95073174-95073196 CCGAGCTCAGCCTTTCTGCAGAT No data
Right 1131712677 15:95073199-95073221 CATCAGCAGAGGCAGCAATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131712674 Original CRISPR ATCTGCAGAAAGGCTGAGCT CGG (reversed) Intergenic
No off target data available for this crispr