ID: 1131713974

View in Genome Browser
Species Human (GRCh38)
Location 15:95088325-95088347
Sequence GGTAAACCGAACGTTATCAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131713974_1131713981 27 Left 1131713974 15:95088325-95088347 CCTATGATAACGTTCGGTTTACC No data
Right 1131713981 15:95088375-95088397 CAGCATGATTAGATGCTACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131713974 Original CRISPR GGTAAACCGAACGTTATCAT AGG (reversed) Intergenic
No off target data available for this crispr