ID: 1131713977

View in Genome Browser
Species Human (GRCh38)
Location 15:95088346-95088368
Sequence AATCAGCTGTCCCTGGGATC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131713977_1131713981 6 Left 1131713977 15:95088346-95088368 CCCGATCCCAGGGACAGCTGATT No data
Right 1131713981 15:95088375-95088397 CAGCATGATTAGATGCTACAAGG No data
1131713977_1131713982 11 Left 1131713977 15:95088346-95088368 CCCGATCCCAGGGACAGCTGATT No data
Right 1131713982 15:95088380-95088402 TGATTAGATGCTACAAGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131713977 Original CRISPR AATCAGCTGTCCCTGGGATC GGG (reversed) Intergenic
No off target data available for this crispr