ID: 1131713980

View in Genome Browser
Species Human (GRCh38)
Location 15:95088353-95088375
Sequence GTATATGAATCAGCTGTCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131713980_1131713982 4 Left 1131713980 15:95088353-95088375 CCAGGGACAGCTGATTCATATAC No data
Right 1131713982 15:95088380-95088402 TGATTAGATGCTACAAGGAGAGG No data
1131713980_1131713981 -1 Left 1131713980 15:95088353-95088375 CCAGGGACAGCTGATTCATATAC No data
Right 1131713981 15:95088375-95088397 CAGCATGATTAGATGCTACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131713980 Original CRISPR GTATATGAATCAGCTGTCCC TGG (reversed) Intergenic
No off target data available for this crispr