ID: 1131713981

View in Genome Browser
Species Human (GRCh38)
Location 15:95088375-95088397
Sequence CAGCATGATTAGATGCTACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131713977_1131713981 6 Left 1131713977 15:95088346-95088368 CCCGATCCCAGGGACAGCTGATT No data
Right 1131713981 15:95088375-95088397 CAGCATGATTAGATGCTACAAGG No data
1131713979_1131713981 0 Left 1131713979 15:95088352-95088374 CCCAGGGACAGCTGATTCATATA No data
Right 1131713981 15:95088375-95088397 CAGCATGATTAGATGCTACAAGG No data
1131713980_1131713981 -1 Left 1131713980 15:95088353-95088375 CCAGGGACAGCTGATTCATATAC No data
Right 1131713981 15:95088375-95088397 CAGCATGATTAGATGCTACAAGG No data
1131713974_1131713981 27 Left 1131713974 15:95088325-95088347 CCTATGATAACGTTCGGTTTACC No data
Right 1131713981 15:95088375-95088397 CAGCATGATTAGATGCTACAAGG No data
1131713978_1131713981 5 Left 1131713978 15:95088347-95088369 CCGATCCCAGGGACAGCTGATTC No data
Right 1131713981 15:95088375-95088397 CAGCATGATTAGATGCTACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131713981 Original CRISPR CAGCATGATTAGATGCTACA AGG Intergenic
No off target data available for this crispr