ID: 1131715561

View in Genome Browser
Species Human (GRCh38)
Location 15:95106944-95106966
Sequence ATGAGTAAACAGAGGCATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131715561_1131715564 -10 Left 1131715561 15:95106944-95106966 CCTCCATGCCTCTGTTTACTCAT No data
Right 1131715564 15:95106957-95106979 GTTTACTCATCTAGAAAATGAGG No data
1131715561_1131715566 12 Left 1131715561 15:95106944-95106966 CCTCCATGCCTCTGTTTACTCAT No data
Right 1131715566 15:95106979-95107001 GCTATTGGCAGAGACGTAGTTGG No data
1131715561_1131715565 -3 Left 1131715561 15:95106944-95106966 CCTCCATGCCTCTGTTTACTCAT No data
Right 1131715565 15:95106964-95106986 CATCTAGAAAATGAGGCTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131715561 Original CRISPR ATGAGTAAACAGAGGCATGG AGG (reversed) Intergenic
No off target data available for this crispr