ID: 1131719045

View in Genome Browser
Species Human (GRCh38)
Location 15:95147212-95147234
Sequence CTGGAGAAGCCCAAAGAGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131719041_1131719045 9 Left 1131719041 15:95147180-95147202 CCTCTCATTCTTATACTAGTGAA No data
Right 1131719045 15:95147212-95147234 CTGGAGAAGCCCAAAGAGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131719045 Original CRISPR CTGGAGAAGCCCAAAGAGTA GGG Intergenic
No off target data available for this crispr