ID: 1131720512

View in Genome Browser
Species Human (GRCh38)
Location 15:95163398-95163420
Sequence GGTGAGGTGGGGCACGGTGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131720506_1131720512 -6 Left 1131720506 15:95163381-95163403 CCATCATCTAACACAGGGGTGAG No data
Right 1131720512 15:95163398-95163420 GGTGAGGTGGGGCACGGTGACGG No data
1131720502_1131720512 7 Left 1131720502 15:95163368-95163390 CCAGACGAAGAAACCATCATCTA No data
Right 1131720512 15:95163398-95163420 GGTGAGGTGGGGCACGGTGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131720512 Original CRISPR GGTGAGGTGGGGCACGGTGA CGG Intergenic
No off target data available for this crispr