ID: 1131720756

View in Genome Browser
Species Human (GRCh38)
Location 15:95166074-95166096
Sequence ATCTGCTGGTACCTTGATTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131720756_1131720761 16 Left 1131720756 15:95166074-95166096 CCAAAATCAAGGTACCAGCAGAT No data
Right 1131720761 15:95166113-95166135 TCCTGCTTCCCGGCTCAGAAAGG No data
1131720756_1131720759 6 Left 1131720756 15:95166074-95166096 CCAAAATCAAGGTACCAGCAGAT No data
Right 1131720759 15:95166103-95166125 TCCAGTAAGATCCTGCTTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131720756 Original CRISPR ATCTGCTGGTACCTTGATTT TGG (reversed) Intergenic
No off target data available for this crispr