ID: 1131726561

View in Genome Browser
Species Human (GRCh38)
Location 15:95232501-95232523
Sequence ATCTTCCTTTTTAATATCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131726561_1131726565 -1 Left 1131726561 15:95232501-95232523 CCCTAGATATTAAAAAGGAAGAT No data
Right 1131726565 15:95232523-95232545 TCTGAAAAGTTACCAGAGTGGGG No data
1131726561_1131726564 -2 Left 1131726561 15:95232501-95232523 CCCTAGATATTAAAAAGGAAGAT No data
Right 1131726564 15:95232522-95232544 ATCTGAAAAGTTACCAGAGTGGG No data
1131726561_1131726566 7 Left 1131726561 15:95232501-95232523 CCCTAGATATTAAAAAGGAAGAT No data
Right 1131726566 15:95232531-95232553 GTTACCAGAGTGGGGAAAATAGG No data
1131726561_1131726568 23 Left 1131726561 15:95232501-95232523 CCCTAGATATTAAAAAGGAAGAT No data
Right 1131726568 15:95232547-95232569 AAATAGGTTATCTAAAGATATGG No data
1131726561_1131726563 -3 Left 1131726561 15:95232501-95232523 CCCTAGATATTAAAAAGGAAGAT No data
Right 1131726563 15:95232521-95232543 GATCTGAAAAGTTACCAGAGTGG No data
1131726561_1131726569 27 Left 1131726561 15:95232501-95232523 CCCTAGATATTAAAAAGGAAGAT No data
Right 1131726569 15:95232551-95232573 AGGTTATCTAAAGATATGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131726561 Original CRISPR ATCTTCCTTTTTAATATCTA GGG (reversed) Intergenic
No off target data available for this crispr