ID: 1131726564

View in Genome Browser
Species Human (GRCh38)
Location 15:95232522-95232544
Sequence ATCTGAAAAGTTACCAGAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131726562_1131726564 -3 Left 1131726562 15:95232502-95232524 CCTAGATATTAAAAAGGAAGATC No data
Right 1131726564 15:95232522-95232544 ATCTGAAAAGTTACCAGAGTGGG No data
1131726561_1131726564 -2 Left 1131726561 15:95232501-95232523 CCCTAGATATTAAAAAGGAAGAT No data
Right 1131726564 15:95232522-95232544 ATCTGAAAAGTTACCAGAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131726564 Original CRISPR ATCTGAAAAGTTACCAGAGT GGG Intergenic
No off target data available for this crispr