ID: 1131726569

View in Genome Browser
Species Human (GRCh38)
Location 15:95232551-95232573
Sequence AGGTTATCTAAAGATATGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131726561_1131726569 27 Left 1131726561 15:95232501-95232523 CCCTAGATATTAAAAAGGAAGAT No data
Right 1131726569 15:95232551-95232573 AGGTTATCTAAAGATATGGAAGG No data
1131726567_1131726569 -7 Left 1131726567 15:95232535-95232557 CCAGAGTGGGGAAAATAGGTTAT No data
Right 1131726569 15:95232551-95232573 AGGTTATCTAAAGATATGGAAGG No data
1131726562_1131726569 26 Left 1131726562 15:95232502-95232524 CCTAGATATTAAAAAGGAAGATC No data
Right 1131726569 15:95232551-95232573 AGGTTATCTAAAGATATGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131726569 Original CRISPR AGGTTATCTAAAGATATGGA AGG Intergenic
No off target data available for this crispr