ID: 1131732829

View in Genome Browser
Species Human (GRCh38)
Location 15:95300218-95300240
Sequence TGCACGCATGTTAGTGAGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131732824_1131732829 12 Left 1131732824 15:95300183-95300205 CCAGTCTTGGTTATGCACTATAT No data
Right 1131732829 15:95300218-95300240 TGCACGCATGTTAGTGAGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131732829 Original CRISPR TGCACGCATGTTAGTGAGTG TGG Intergenic