ID: 1131741958

View in Genome Browser
Species Human (GRCh38)
Location 15:95402565-95402587
Sequence CAGTGAGGTCCTGTAGAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131741958_1131741962 -9 Left 1131741958 15:95402565-95402587 CCTTTTTCTACAGGACCTCACTG No data
Right 1131741962 15:95402579-95402601 ACCTCACTGTGGCTGGTAGGTGG No data
1131741958_1131741964 24 Left 1131741958 15:95402565-95402587 CCTTTTTCTACAGGACCTCACTG No data
Right 1131741964 15:95402612-95402634 ATACATGTTCATGAAGCAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131741958 Original CRISPR CAGTGAGGTCCTGTAGAAAA AGG (reversed) Intergenic
No off target data available for this crispr