ID: 1131743660

View in Genome Browser
Species Human (GRCh38)
Location 15:95421487-95421509
Sequence CCAAAATAGAGCTCGGGCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131743660_1131743673 29 Left 1131743660 15:95421487-95421509 CCATGGCCCGAGCTCTATTTTGG No data
Right 1131743673 15:95421539-95421561 ATGCAGGGCACCAAGTCCCTAGG 0: 232
1: 419
2: 770
3: 967
4: 988
1131743660_1131743664 -8 Left 1131743660 15:95421487-95421509 CCATGGCCCGAGCTCTATTTTGG No data
Right 1131743664 15:95421502-95421524 TATTTTGGCCCTTTCAGCCATGG No data
1131743660_1131743665 -4 Left 1131743660 15:95421487-95421509 CCATGGCCCGAGCTCTATTTTGG No data
Right 1131743665 15:95421506-95421528 TTGGCCCTTTCAGCCATGGCTGG No data
1131743660_1131743668 5 Left 1131743660 15:95421487-95421509 CCATGGCCCGAGCTCTATTTTGG No data
Right 1131743668 15:95421515-95421537 TCAGCCATGGCTGGAGCAGCTGG 0: 147
1: 253
2: 556
3: 720
4: 1259
1131743660_1131743669 6 Left 1131743660 15:95421487-95421509 CCATGGCCCGAGCTCTATTTTGG No data
Right 1131743669 15:95421516-95421538 CAGCCATGGCTGGAGCAGCTGGG 0: 142
1: 253
2: 562
3: 687
4: 1159
1131743660_1131743672 14 Left 1131743660 15:95421487-95421509 CCATGGCCCGAGCTCTATTTTGG No data
Right 1131743672 15:95421524-95421546 GCTGGAGCAGCTGGGATGCAGGG 0: 187
1: 430
2: 906
3: 1199
4: 1748
1131743660_1131743671 13 Left 1131743660 15:95421487-95421509 CCATGGCCCGAGCTCTATTTTGG No data
Right 1131743671 15:95421523-95421545 GGCTGGAGCAGCTGGGATGCAGG 0: 108
1: 295
2: 715
3: 1185
4: 1991

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131743660 Original CRISPR CCAAAATAGAGCTCGGGCCA TGG (reversed) Intergenic
No off target data available for this crispr