ID: 1131748033

View in Genome Browser
Species Human (GRCh38)
Location 15:95471311-95471333
Sequence CTTAAACATATGTAGCTTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131748030_1131748033 -10 Left 1131748030 15:95471298-95471320 CCCCTTGGTTGTTCTTAAACATA No data
Right 1131748033 15:95471311-95471333 CTTAAACATATGTAGCTTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131748033 Original CRISPR CTTAAACATATGTAGCTTTA AGG Intergenic
No off target data available for this crispr