ID: 1131748926

View in Genome Browser
Species Human (GRCh38)
Location 15:95484533-95484555
Sequence GCCATAATTTCCTCCATTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131748926_1131748927 -9 Left 1131748926 15:95484533-95484555 CCAGTAATGGAGGAAATTATGGC No data
Right 1131748927 15:95484547-95484569 AATTATGGCAAATAACGAAAAGG No data
1131748926_1131748928 12 Left 1131748926 15:95484533-95484555 CCAGTAATGGAGGAAATTATGGC No data
Right 1131748928 15:95484568-95484590 GGCAAAAATCTTCCATTATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131748926 Original CRISPR GCCATAATTTCCTCCATTAC TGG (reversed) Intergenic
No off target data available for this crispr