ID: 1131748927

View in Genome Browser
Species Human (GRCh38)
Location 15:95484547-95484569
Sequence AATTATGGCAAATAACGAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131748926_1131748927 -9 Left 1131748926 15:95484533-95484555 CCAGTAATGGAGGAAATTATGGC No data
Right 1131748927 15:95484547-95484569 AATTATGGCAAATAACGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131748927 Original CRISPR AATTATGGCAAATAACGAAA AGG Intergenic
No off target data available for this crispr