ID: 1131749454

View in Genome Browser
Species Human (GRCh38)
Location 15:95490951-95490973
Sequence CACTGTCAATGTCATTAAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131749454_1131749456 19 Left 1131749454 15:95490951-95490973 CCTACTTAATGACATTGACAGTG No data
Right 1131749456 15:95490993-95491015 AAGCTGACTTCTTAATGTAAAGG No data
1131749454_1131749457 22 Left 1131749454 15:95490951-95490973 CCTACTTAATGACATTGACAGTG No data
Right 1131749457 15:95490996-95491018 CTGACTTCTTAATGTAAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131749454 Original CRISPR CACTGTCAATGTCATTAAGT AGG (reversed) Intergenic
No off target data available for this crispr