ID: 1131750880

View in Genome Browser
Species Human (GRCh38)
Location 15:95506965-95506987
Sequence ATTTAAGTGGGCCGGGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 130}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131750873_1131750880 24 Left 1131750873 15:95506918-95506940 CCTACTATCTATCAAAAGCAACA 0: 1
1: 0
2: 1
3: 14
4: 225
Right 1131750880 15:95506965-95506987 ATTTAAGTGGGCCGGGAGGATGG 0: 1
1: 0
2: 0
3: 15
4: 130
1131750874_1131750880 -8 Left 1131750874 15:95506950-95506972 CCTGACTTTAAAAATATTTAAGT 0: 1
1: 0
2: 9
3: 94
4: 891
Right 1131750880 15:95506965-95506987 ATTTAAGTGGGCCGGGAGGATGG 0: 1
1: 0
2: 0
3: 15
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131750880 Original CRISPR ATTTAAGTGGGCCGGGAGGA TGG Intergenic