ID: 1131753662

View in Genome Browser
Species Human (GRCh38)
Location 15:95537386-95537408
Sequence CCTGGCACTCCACAGATACC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 162}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131753654_1131753662 25 Left 1131753654 15:95537338-95537360 CCCTGCCAGTCCTGGTTCTTGCT No data
Right 1131753662 15:95537386-95537408 CCTGGCACTCCACAGATACCCGG 0: 1
1: 0
2: 3
3: 15
4: 162
1131753655_1131753662 24 Left 1131753655 15:95537339-95537361 CCTGCCAGTCCTGGTTCTTGCTT No data
Right 1131753662 15:95537386-95537408 CCTGGCACTCCACAGATACCCGG 0: 1
1: 0
2: 3
3: 15
4: 162
1131753657_1131753662 15 Left 1131753657 15:95537348-95537370 CCTGGTTCTTGCTTCCAGTTTGA No data
Right 1131753662 15:95537386-95537408 CCTGGCACTCCACAGATACCCGG 0: 1
1: 0
2: 3
3: 15
4: 162
1131753656_1131753662 20 Left 1131753656 15:95537343-95537365 CCAGTCCTGGTTCTTGCTTCCAG No data
Right 1131753662 15:95537386-95537408 CCTGGCACTCCACAGATACCCGG 0: 1
1: 0
2: 3
3: 15
4: 162
1131753658_1131753662 1 Left 1131753658 15:95537362-95537384 CCAGTTTGATGATTTAGCAACCT No data
Right 1131753662 15:95537386-95537408 CCTGGCACTCCACAGATACCCGG 0: 1
1: 0
2: 3
3: 15
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131753662 Original CRISPR CCTGGCACTCCACAGATACC CGG Intergenic