ID: 1131755092

View in Genome Browser
Species Human (GRCh38)
Location 15:95550867-95550889
Sequence TTTATCTCTTAAGTCTTATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131755091_1131755092 11 Left 1131755091 15:95550833-95550855 CCAGTGACACGGATCATAATGAA No data
Right 1131755092 15:95550867-95550889 TTTATCTCTTAAGTCTTATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131755092 Original CRISPR TTTATCTCTTAAGTCTTATT TGG Intergenic
No off target data available for this crispr