ID: 1131773320

View in Genome Browser
Species Human (GRCh38)
Location 15:95765109-95765131
Sequence TATGAAGAAACACCCAAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131773318_1131773320 -7 Left 1131773318 15:95765093-95765115 CCCATTCTCACACTGCTATGAAG 0: 5
1: 56
2: 169
3: 272
4: 462
Right 1131773320 15:95765109-95765131 TATGAAGAAACACCCAAAACTGG No data
1131773319_1131773320 -8 Left 1131773319 15:95765094-95765116 CCATTCTCACACTGCTATGAAGA 0: 237
1: 1272
2: 3343
3: 3692
4: 3639
Right 1131773320 15:95765109-95765131 TATGAAGAAACACCCAAAACTGG No data
1131773317_1131773320 19 Left 1131773317 15:95765067-95765089 CCAACTATTATACATAGTTGTAT No data
Right 1131773320 15:95765109-95765131 TATGAAGAAACACCCAAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131773320 Original CRISPR TATGAAGAAACACCCAAAAC TGG Intergenic
No off target data available for this crispr