ID: 1131775262

View in Genome Browser
Species Human (GRCh38)
Location 15:95788466-95788488
Sequence TTTTTATCACTTATGGTACA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131775262_1131775265 17 Left 1131775262 15:95788466-95788488 CCGTGTACCATAAGTGATAAAAA No data
Right 1131775265 15:95788506-95788528 TGGCTTTTATCAATGCACTCAGG No data
1131775262_1131775264 -3 Left 1131775262 15:95788466-95788488 CCGTGTACCATAAGTGATAAAAA No data
Right 1131775264 15:95788486-95788508 AAATGTAATGTTTTTATTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131775262 Original CRISPR TTTTTATCACTTATGGTACA CGG (reversed) Intergenic
No off target data available for this crispr