ID: 1131777982

View in Genome Browser
Species Human (GRCh38)
Location 15:95823118-95823140
Sequence CTGGCTCTCCGCCCTGCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131777982_1131777993 30 Left 1131777982 15:95823118-95823140 CCAGGAGCAGGGCGGAGAGCCAG No data
Right 1131777993 15:95823171-95823193 GACTCAGGGAACTGGCTTCTGGG No data
1131777982_1131777985 -4 Left 1131777982 15:95823118-95823140 CCAGGAGCAGGGCGGAGAGCCAG No data
Right 1131777985 15:95823137-95823159 CCAGGCACCTGAGCCTCTGCTGG No data
1131777982_1131777989 15 Left 1131777982 15:95823118-95823140 CCAGGAGCAGGGCGGAGAGCCAG No data
Right 1131777989 15:95823156-95823178 CTGGCAACGTGGAGAGACTCAGG No data
1131777982_1131777991 22 Left 1131777982 15:95823118-95823140 CCAGGAGCAGGGCGGAGAGCCAG No data
Right 1131777991 15:95823163-95823185 CGTGGAGAGACTCAGGGAACTGG No data
1131777982_1131777990 16 Left 1131777982 15:95823118-95823140 CCAGGAGCAGGGCGGAGAGCCAG No data
Right 1131777990 15:95823157-95823179 TGGCAACGTGGAGAGACTCAGGG No data
1131777982_1131777992 29 Left 1131777982 15:95823118-95823140 CCAGGAGCAGGGCGGAGAGCCAG No data
Right 1131777992 15:95823170-95823192 AGACTCAGGGAACTGGCTTCTGG No data
1131777982_1131777987 4 Left 1131777982 15:95823118-95823140 CCAGGAGCAGGGCGGAGAGCCAG No data
Right 1131777987 15:95823145-95823167 CTGAGCCTCTGCTGGCAACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131777982 Original CRISPR CTGGCTCTCCGCCCTGCTCC TGG (reversed) Intergenic
No off target data available for this crispr