ID: 1131779937

View in Genome Browser
Species Human (GRCh38)
Location 15:95845244-95845266
Sequence TTTCTCCTGTCACCAAAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131779937_1131779938 0 Left 1131779937 15:95845244-95845266 CCTGTCTTTGGTGACAGGAGAAA No data
Right 1131779938 15:95845267-95845289 ATAAAACCTAAGACTTTTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131779937 Original CRISPR TTTCTCCTGTCACCAAAGAC AGG (reversed) Intergenic
No off target data available for this crispr