ID: 1131786229

View in Genome Browser
Species Human (GRCh38)
Location 15:95914003-95914025
Sequence CACTGTGTAGGGAGGGGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131786219_1131786229 -2 Left 1131786219 15:95913982-95914004 CCAACATATCCACTCTTTATCCA No data
Right 1131786229 15:95914003-95914025 CACTGTGTAGGGAGGGGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131786229 Original CRISPR CACTGTGTAGGGAGGGGGGA TGG Intergenic
No off target data available for this crispr